AJLM African Journal of Laboratory Medicine 2225-2002 2225-2010 AOSIS AJLM-12-2107 10.4102/ajlm.v12i1.2107 Brief Report Characterisation of genes encoding for extended spectrum β-lactamase in Gram-negative bacteria causing healthcare-associated infections in Mwanza, Tanzania https://orcid.org/0000-0002-3733-0404 Mwakyabala Jenipher G. 1 https://orcid.org/0000-0001-7962-3443 Mtemisika Conjester I. 2 https://orcid.org/0000-0002-5088-3150 Mshana Stacy 1 https://orcid.org/0000-0002-7560-3012 Mwakyoma Adam A. 3 https://orcid.org/0000-0002-4178-3254 Silago Vitus 1 Department of Microbiology and Immunology, Weill Bugando School of Medicine, Catholic University of Health and Allied Sciences, Mwanza, United Republic of Tanzania Molecular Biology Laboratory, Central Pathology Laboratory, Bugando Medical Centre, Mwanza, United Republic of Tanzania Department of Clinical Microbiology, Kilimanjaro Christian Medical Centre, Moshi, United Republic of Tanzania Corresponding author: Conjester Mtemisika, conjestermtemisika@yahoo.com 12042023 2023 12 1 2107 30102022 27012023 © 2023. The Authors 2023 Licensee: AOSIS. This work is licensed under the Creative Commons Attribution License.

Healthcare-associated infections (HCAIs) caused by extended spectrum β-lactamase-producing Gram-negative bacteria (ESBL-GNB) increase morbidity and mortality. This cross-sectional study characterised ESBL genes (blaCTX-M, blaTEM and blaSHV) among 30 ceftriaxone-resistant GNB causing HCAIs between January 2022 and July 2022 by multiplex polymerase chain reaction assay at the zonal referral hospital in Mwanza, Tanzania. Twenty-five (83.3%) had at least one ESBL gene, of which 23/25 (92.0%) carried the blaCTX-M gene. Seventy-two percent (18/25) of the GNB-ESBL isolates carried more than one ESBL gene, of which the majority (88.8%; n = 16/25) carried the blaCTX-M and blaTEM genes. Extended spectrum β-lactamase genes, particularly blaCTX-M, are common among ceftriaxone-resistant GNB causing HCAIs.

What this study adds

This study revealed the distribution of genes (blaCTX-M, blaTEM and blaSHV) coding for ESBL production among ceftriaxone resistant GNB causing HCAIs However, all ESBL producing GNB were susceptible towards ceftriaxone-sulbactam indicating that ceftriaxone-sulbactam may be empirically prescribed for treating patients with HCAIs.

 beta lactamases extended spectrum beta-lactamase Gram-negative bacteria healthcare-associated infections multiplex PCR assay Introduction

Healthcare-associated infections (HCAIs), also referred to as nosocomial infections, are infections acquired by patients while receiving healthcare services from ≥ 48 h after admission to a healthcare facility.1,2,3 Admission into intensive care units increases the risk of acquiring HCAIs due to (1) chronic diseases which lower body immunity; (2) surgical procedures which interfere with natural body defenses; and (3) medical invasive devices such as urinary catheters, central lines and intubators, which provide bacteria with direct entry into bodily tissues.4 Escherichia coli, Klebsiella aerogenes, Enterobacter spp., Acinetobacter baumannii and Pseudomonas aeruginosa are the most common Gram-negative bacteria (GNB) known to cause HCAIs.5,6,7,8

Healthcare-associated infections are associated with significant increased cost of healthcare services, days of hospitalisation and mortality.9 Healthcare-associated infections caused by multidrug-resistant bacteria phenotypes, such as extended spectrum β-lactamase-producing GNB (ESBL-GNB), further exaggerate morbidity and mortality. At the study site in Mwanza, Tanzania, the prevalence of HCAIs in surgical site infections ranges from 10% to 26%.5,9,10 Staphylococcus aureus accounts for nearly one-third of these, of which about 16% to 19% are methicillin resistant.5,9 On the other hand, only one study reported 13% of implicating GNB showed ESBL phenotypes.9 To date, the distribution of ESBL genes among ESBL-GNB phenotypes causing HCAIs is not clearly known. This study unravels the distributions of ESBL genes (blaCTX-M, blaTEM and blaSHV) among ceftriaxone-resistant GNB causing HCAIs at a zonal referral hospital in Mwanza, Tanzania.

 Methods Ethical considerations

This study received ethical approval from the joint Catholic University of Health and Allied Sciences and Bugando Medical Centre Research Ethics and Review Committee. The study approval number is CREC: 2368/2022. All participants voluntarily provided written informed consent before being enrolled in the study. Unique identification numbers were used to ensure confidentiality. Laboratory results were communicated in a timely manner to attending doctors in order to guide rational therapy.

 Study design, population, setting and duration

This was a cross-sectional laboratory-based study of ceftriaxone-resistant GNB isolated from different HCAIs between January 2022 and July 2022 (unpublished data) at Bugando Medical Centre – a zonal referral hospital located in Mwanza, Tanzania. The bacterial isolates, which had been archived in 20% glycerol stocks stored in a –40 °C freezer in the Microbiology laboratory as part of a biorepository, were recovered for this study in July 2022. The duration of archive ranged from 1 to 6 months before recovery for molecular characterisation of ESBL genes. Clinical information related to each isolate, namely ward or clinic of origin, sample type, bacterial species name, and susceptibility towards third-generation cephalosporins, notably ceftriaxone, was extracted from the laboratory database. Laboratory procedures were conducted in Microbiology Research Laboratory and Molecular Biology Research Laboratory at the Catholic University of Health and Allied Sciences located at Bugando Medical Centre in Mwanza, Tanzania.

 Definition of healthcare-associated infection

In the current study, HCAI was defined as an infection that a patient develops after 48 h of hospital admission, while receiving healthcare for another disease or condition.11

 Laboratory procedure Recovery of CRO-R-GNB causing healthcare-associated infections and phenotypic detection of ESBL production

Ceftriaxone-resistant GNB causing HCAIs were recovered by sub-culturing on plates of MacConkey agar with salt (MCA; HiMedia, Mumbai, India). Plates were incubated aerobically at 35 °C ± 2 °C for 20 h – 24 h followed by phenotypic detection of ESBL production and DNA extraction for multiplex polymerase chain reaction (PCR) assay. The disk combination method (DCM) from the Clinical and Laboratory Standards Institute12 was used for phenotypic detection of ESBL production among recovered ceftriaxone-resistant GNB.

 DNA extraction

From 5 to 10 fresh colonies (≤ 24 h) of ceftriaxone-resistant GNB on plates of MCA were used for DNA extraction. A protocol for DNA extraction from GNB by QIAmp Min DNA extraction kit (QIAGEN, Wuerzburg, Germany) was used according to manufacturer’s instructions. DNA samples were stored at −20 °C.

 Multiplex PCR assay

A multiplex PCR assay described by Monstein et al.13 was used for amplification and detection of ESBL genes (blaCTX-M, blaSHV, and blaTEM). Briefly, 2 µL of each DNA sample was added into a PCR reaction tube containing HotStarTaq DNA polymerase master mix (New England Biolabs; Hitchin, Hertfordshire, United Kingdom) and a set of primers (Table 1), resulting in a final PCR reaction volume of 25 µL. The thermal cycler (T100™, BIO-RAD, Kaki-Bukit, Singapore) was run with the following conditions: initial denaturation at 95 °C for 5 min; 30 cycles of denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min; and a final extension at 72 °C for 10 min. Products were detected by using a 1% agarose gel with Tris-acetate-EDTA buffer stained with SafeViewTM DNA stain (ABM; Richmond, British Colombia, Canada) and visualised under ultraviolet light.

Sequences of primers used for multiplex polymerase chain reaction assays for extended spectrum β-lactamase genes, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.

Primer Sequence (5ʹ-3ʹ direction) Amplicon size Reference
bla-SHV.SE forward ATGCGTTATATTCGCCTGTG 747 bp Monstein et al.13
bla-SHV.AS reverse TGCTTTGTTATTCGGGCCAA
TEM-164.SE forward TCGCCGCATACACTATTCTCAGAATGA 445 bp
TEM-165.AS reverse ACGCTCACCGGCTCCAGATTTAT
CTX-M-U1 forward ATGTGCAGYACCAGTAARGTKATGGC 593 bp
CTX-M-U2 reverse TGGGTRAARTARGTSACCAGAAYCAGCGG

Source: Adapted from Monstein HJ, Ostholm-Balkhed A, Nilsson MV, Nilsson M, Dornbusch K, Nilsson LE. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS. 2007;115(12):1400–1408. https://doi.org/10.1111/j.1600-0463.2007.00722.x

bp, base pairs.

 Data management and analysis

Quantitative data were descriptively analysed by using Microsoft Excel (Microsoft Office; Redmond, Washington, United States) and Stata version 15.0 (StataCorp LLP; College Station, Texas, United States; https://www.stata.com/stata15/).

 Results

A total of 30 ceftriaxone-resistant GNB causing HCAIs were recovered during this study period. Most of the recovered bacteria were E. coli 43.3% (n = 13). The majority of ceftriaxone-resistant GNB were isolated from the burn unit (40%; n = 12), and from pus/pus swab samples (56.6%; n = 17). By DCM, all (100%; n = 30) ceftriaxone-resistant GNB had positive ESBL phenotypes. Multiplex PCR assay revealed that about 83.3% (n = 25) had at least one ESBL gene, of which the majority (92.0%; n = 23) harboured the blaCTX-M gene. Out of 25 GNB carrying ESBL genes, 18 (72.0%) carried multiple genes; of these, 88.8% (n = 16) carried blaCTX-M and blaTEM genes (Table 2 and Figure 1). Five isolates with negative PCR were E. coli (n = 3), isolated from pus/pus swab samples in the burn unit, and Acinetobacter spp. (n = 2), one isolated from a urine sample in the medical ward and the other isolated from a pus/pus swab sample from the neonatal intensive care unit (Table 3).

Molecular characterisation of extended spectrum β-lactamase genes by multiplex polymerase chain reaction assay, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.

Description of ceftriaxone-resistant GNB recovered for multiplex polymerase chain reaction amplification and detection of extended spectrum β-lactamase genes, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.

Variable Frequency (n) Percentage (%)
Ward/unit of isolation
 Burn unit 12 40.0
 NICU 7 23.3
 PICU 5 16.6
 Medical ward 4 13.3
 AICU 2 6.6
Sample of origin
 Pus or pus swab 17 56.6
 Urine 7 23.3
 Blood 6 19.9
Isolate name
E. coli 13 43.3
K. aerogenes 7 23.3
E. cloacae 3 10.0
Acinetobacter spp. 3 10.0
P. aeruginosa 2 6.6
K. oxytoca 1 3.3
A. hydrophilia 1 3.3
Disk combination method results
 Positive 30 100.0
 Negative 0 0.0
Multiplex PCR amplification results
 Positive 25 83.3
 Negative 5 16.7
Type of ESBL gene
 blaCTX-M 23 92.0
 blaTEM 18 64.2
 blaSHV 2 8.0
Multiple ESBL genes
 Yes 18 72.0
 No 1 28.0
Type of multiple ESBL genes
 blaCTX-M and blaTEM 16 88.8
 blaCTX-M and blaSHV 1 5.6
 blaCTX-M and blaTEM and blaSHV 1 5.6

AICU, adult intensive care unit; NICU, neonatal intensive care unit; PICU, paediatric intensive care unit; ESBL, extended spectrum β-lactamase; PCR, polymerase chain reaction.

Results of disk combination method and multiplex PCR assay, and distributions of ESBL genes, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.

Isolate ID Ward/unit Sample Species name DCM PCR ESBL family
SHV TEM CTX-M
013HCAI AICU Blood K. aerogenes Pos Pos - + +
098HCAI AICU Urine E. coli Pos Pos - + -
001HCAI Burn unit Pus Acinetobacter spp. Pos Pos - - +
002HCAI Burn unit Pus E. coli Pos Pos - + +
004HCAI Burn unit Pus K. aerogenes Pos Pos - + +
009HCAI Burn unit Pus E. cloacae Pos Pos - + +
010HCAI Burn unit Pus K. aerogenes Pos Pos - + +
051HCAI Burn unit Pus E. coli Pos Pos - + +
062HCAI Burn unit Pus E. coli Pos Neg - - -
063HCAI Burn unit Pus E. coli Pos Pos - + +
071HCAI Burn unit Pus E. coli Pos Neg - - -
092HCAI Burn unit Pus P. aeruginosa Pos Pos - - +
093HCAI Burn unit Pus A. hydrophila Pos Pos - - +
094HCAI Burn unit Pus E. coli Pos Neg - - -
04HCAI-1 Medical ward Urine E. coli Pos Pos - + +
04HCAI-2 Medical ward Urine P. aeruginosa Pos Pos - + +
08HCAI Medical ward Urine Acinetobacter spp. Pos Neg - - -
020HCAI Medical ward Urine E. coli Pos Pos - + +
014HCAI NICU Pus Acinetobacter spp. Pos Neg - - -
021HCAI-1 NICU Pus E. coli Pos Pos - + +
021HCAI-2 NICU Pus K. aerogenes Pos Pos - - +
036HCAI NICU Pus K. aerogenes Pos Pos - - +
081HCAI NICU Blood E. cloacae Pos Pos - + -
082HCAI NICU Blood E. cloacae Pos Pos + + +
091HCAI NICU Pus K. aerogenes Pos Pos - + +
020HCAI PICU Blood E. coli Pos Pos - - +
077HCAI PICU Blood E. coli Pos Pos - + +
079HCAI-1 PICU Urine E. coli Pos Pos - + +
079HCAI-2 PICU Urine K. oxytoca Pos Pos + - +
086HCAI PICU Blood K. aerogenes Pos Pos - + +

HCAI, healthcare-associated infection; AICU, adult intensive care unit; NICU, neonatal intensive care unit; PICU, paediatric intensive care unit; DCM, disk combination method; ESBL, extended spectrum β-lactamase; SHV, sulfhydryl reagent variable beta-lactamase; TEM, temoniera beta-lactamase; CTX-M, cefotaximase-Munich β-lactamase; PCR, polymerase chain reaction; Pos, positive; Neg, negative.

 Discussion

The current study characterised the proportions and distributions of ESBL genes (blaCTX-M, blaTEM, and blaSHV) among ceftriaxone-resistant GNB which were isolated from different HCAIs between January 2022 and July 2022 at a tertiary zonal referral hospital in Mwanza, Tanzania. The majority of ceftriaxone-resistant GNB were recovered from the burn unit, from patients with burn injuries who were prone to infections because of the breached skin barrier.14 Moreover, E. coli accounted for the majority of recovered bacterial species, suggesting the patients’ own gut flora as an endogenous source of infection.3 However, E. coli can also be acquired from exogenous sources, such as contaminated inanimate surfaces, whenever hospital environmental cleaning and decontamination are poor.15

This study observed that all ceftriaxone-resistant GNB had positive ESBL phenotypes by DCM, even though four out of five (83.3%) ESBL phenotypes had at least one ESBL gene on multiplex PCR assay. Our findings are similar to a study by Silago et al., conducted in Mwanza, Tanzania, in 2020, which reported a proportion of 93.3% ESBL among GNB isolated from the hospital environment and hospitalised patients at the same setting.16 Our findings are, however, higher than a study by Said et al., which was conducted in 2021 in Mwanza, Tanzania, which reported that about 65.9% of GNB colonising children, of whom the majority were not hospitalised, harboured ESBL genes at the same setting.17 Therefore, the difference in study populations between the studies may explain the difference observed. Similar to previous studies published in 2020 and 2021 in Mwanza and in 2021 in Morogoro, Tanzania,16,17,18 the majority of ceftriaxone-resistant GNB were harbouring the blaCTX-M gene. The predominance of blaCTX-M may be a result of successful dissemination by conjugative epidemic plasmids, which facilitates its horizontal and vertical transmission.16,19,20,21

Five confirmed ESBL phenotypes by DCM did not harbour any of the three ESBL genes (blaCTX-M, blaTEM, and blaSHV) by multiplex PCR assay. This observation is in line with previous studies conducted from the same setting, Mwanza, Tanzania, in 2020 and 2021.16,17 The isolates may be harbouring other ESBL families which are non-cefotaximase-Munich beta-lactamase (non-CTX-M), non-temoniera beta-lactamase (non-TEM), and non-sulfhydryl reagent variable beta-lactamase (non-SHV), such as oxacillinase beta-lactamase, Pseudomonas extended resistant, Vietnam extended-spectrum β-lactamase, Tlahuica Indian- and Guiana-extended spectrum families.22

Limitations

The small sample size of ceftriaxone-resistant GNB isolates obtained for this study is a weakness but did not affect the interpretation of the results.

 Conclusion

Extended spectrum β-lactamase genes, to be specific blaCTX-M, are common among ceftriaxone-resistant GNB causing HCAIs. Therefore, rational management of patients with HCAIs, guided by culture and sensitivity, is warranted.

 Acknowledgements

Authors appreciate the support from Microbiology Research Laboratory and Molecular Biology Laboratory of the Catholic University of Health and Allied Sciences.

Competing interests

The authors declare that they have no financial or personal relationships that may have inappropriately influenced them in writing this article.

 Authors’ contributions

V.S. and A.A.M. conceptualised the idea of the manuscript; J.G.M. and S.M. retrieved laboratory data, recovered bacteria isolates, and performed laboratory procedures; J.G.M. and C.I.M. interpreted and analysed data; C.I.M. wrote the first draft of the manuscript, which was critically reviewed by all co-authors who also approved the final manuscript. V.S. supervised protocols and every step of this research.

 Sources of support

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

 Data availability

The data that support the findings made in this study can be made available from the corresponding author, C.I.M., on request.

 Disclaimer

The views expressed in this study are those of the authors and are not an official position of the affiliation institutes of the authors.

 References Danasekaran R, Mani G, Annadurai K. Prevention of healthcare-associated infections: Protecting patients, saving lives. Int J Community Med Public Health. 2014;1(1):67–68. Peleg AY, Hooper DC. Hospital-acquired infections due to Gram-negative bacteria. N Engl J Med. 2010;362(19):1804–1813. https://doi.org/10.1056/NEJMra0904124 Nagarjuna D, Mittal G, Dhanda RS, Verma PK, Gaind R, Yadav M. Faecal Escherichia coli isolates show potential to cause endogenous infection in patients admitted to the ICU in a tertiary care hospital. New Microbes New Infect. 2015;7:57–66. https://doi.org/10.1016/j.nmni.2015.05.006 World Health Organization. Report on the burden of endemic health care-associated infection worldwide. World Health Organization: Geneva, Switzerland. 2011. Mawalla B, Mshana SE, Chalya PL, Imirzalioglu C, Mahalu W. Predictors of surgical site infections among patients undergoing major surgery at Bugando Medical Centre in Northwestern Tanzania. BMC Surg. 2011;11(1):1–7. https://doi.org/10.1186/1471-2482-11-21 Agarwal S. Study of postoperative wound infection. Indian J Surg. 1972;34:314–320. Nichols RL. Surgical wound infection. Am J Med. 1991;91(3):S54–S64. https://doi.org/10.1016/0002-9343(91)90344-W Kotisso B, Aseffa A. Surgical wound infection in a teaching hospital in Ethiopia. East Afr Med J. 1998;75(7):402–405. Mpogoro FJ, Mshana SE, Mirambo MM, Kidenya BR, Gumodoka B, Imirzalioglu C. Incidence and predictors of surgical site infections following caesarean sections at Bugando Medical Centre, Mwanza, Tanzania. Antimicrob Resist Infect Control. 2014;3(1):1–10. https://doi.org/10.1186/2047-2994-3-25 Moremi N, Claus H, Vogel U, Mshana SE. Surveillance of surgical site infections by Pseudomonas aeruginosa and strain characterization in Tanzanian hospitals does not provide proof for a role of hospital water plumbing systems in transmission. Antimicrob Resist Infect Control. 2017;6(1):1–8. https://doi.org/10.1186/s13756-017-0216-x Haque M, Sartelli M, McKimm J, Abu Bakar M. Health care-associated infections – An overview. Infect Drug Resist. 2018 Nov 15;11:2321–2333. https://doi.org/10.2147/IDR.S177247 CLSI. Performance standards for antimicrobial susceptibility testing. 32nd ed. CLSI supplement M100. Clinical and Laboratory Standards Institute: Berwyn, Pennsylvania. 2022. Monstein HJ, Ostholm-Balkhed A, Nilsson MV, Nilsson M, Dornbusch K, Nilsson LE. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS. 2007;115(12):1400–1408. https://doi.org/10.1111/j.1600-0463.2007.00722.x Church D, Elsayed S, Reid O, Winston B, Lindsay R. Burn wound infections. Clin Microbiol Rev. 2006;19(2):403–434. https://doi.org/10.1128/CMR.19.2.403-434.2006 Odoyo E, Matano D, Georges M, et al. Ten thousand-fold higher than acceptable bacterial loads detected in Kenyan Hospital environments: Targeted approaches to reduce contamination levels. Int J Environ Res Public Health. 2021;18(13):6810. https://www.mdpi.com/1660-4601/18/13/6810 Silago V, Kovacs D, Samson H, et al. Existence of multiple ESBL genes among phenotypically confirmed ESBL producing Klebsiella pneumoniae and Escherichia coli concurrently isolated from clinical, colonization and contamination samples from neonatal units at Bugando Medical Center, Mwanza, Tanzania. Antibiotics. 2021;10(5):476. https://doi.org/10.3390/antibiotics10050476 Said MM, Msanga DR, Mtemisika CI, et al. Extended spectrum β-lactamase producing lactose fermenting bacteria colonizing children with human immunodeficiency virus, sickle cell disease and diabetes mellitus in Mwanza City, Tanzania: A cross-sectional study. Trop Med Infect Dis. 2022;7(8):144. https://doi.org/10.3390/tropicalmed7080144 Moremi N, Silago V, Mselewa EG, et al. Extended-spectrum β-lactamase blaCTX-M-1 group in Gram-negative bacteria colonizing patients admitted at Mazimbu hospital and Morogoro Regional hospital in Morogoro, Tanzania. BMC Res Notes. 2021;14(1):1–7. https://doi.org/10.1186/s13104-021-05495-x Xia S, Fan X, Huang Z, et al. Dominance of CTX-M-type extended-spectrum β-lactamase (ESBL)-producing Escherichia coli isolated from patients with community-onset and hospital-onset infection in China. PLoS One. 2014;9(7):e100707. https://doi.org/10.1371/journal.pone.0100707 Rossolini G, D’Andrea M, Mugnaioli C. The spread of CTX-M-type extended-spectrum β-lactamases. Clin Microbiol Infect. 2008;14:33–41. https://doi.org/10.1111/j.1469-0691.2007.01867.x Zhuo C, Li XQ, Zong ZY, Zhong NS. Epidemic plasmid carrying bla CTX-M-15 in Klebsiella penumoniae in China. PLoS One. 2013;8(1):e52222. https://doi.org/10.1371/journal.pone.0052222 Paterson DL, Bonomo RA. Extended-spectrum β-lactamases: A clinical update. Clin Microbiol Rev. 2005;18(4):657–686. https://doi.org/10.1128/CMR.18.4.657-686.2005

How to cite this article: Mwakyabala JG, Mtemisika CI, Mshana S, Mwakyoma AA, Silago V. Characterisation of genes encoding for extended spectrum β-lactamase in Gram-negative bacteria causing healthcare-associated infections in Mwanza, Tanzania. Afr J Lab Med. 2023;12(1), a2107. https://doi.org/10.4102/ajlm.v12i1.2107