Healthcare-associated infections (HCAIs) caused by extended spectrum β-lactamase-producing Gram-negative bacteria (ESBL-GNB) increase morbidity and mortality. This cross-sectional study characterised ESBL genes (
This study revealed the distribution of genes (
Healthcare-associated infections (HCAIs), also referred to as nosocomial infections, are infections acquired by patients while receiving healthcare services from ≥ 48 h after admission to a healthcare facility.
Healthcare-associated infections are associated with significant increased cost of healthcare services, days of hospitalisation and mortality.
This study received ethical approval from the joint Catholic University of Health and Allied Sciences and Bugando Medical Centre Research Ethics and Review Committee. The study approval number is CREC: 2368/2022. All participants voluntarily provided written informed consent before being enrolled in the study. Unique identification numbers were used to ensure confidentiality. Laboratory results were communicated in a timely manner to attending doctors in order to guide rational therapy.
This was a cross-sectional laboratory-based study of ceftriaxone-resistant GNB isolated from different HCAIs between January 2022 and July 2022 (unpublished data) at Bugando Medical Centre – a zonal referral hospital located in Mwanza, Tanzania. The bacterial isolates, which had been archived in 20% glycerol stocks stored in a –40 °C freezer in the Microbiology laboratory as part of a biorepository, were recovered for this study in July 2022. The duration of archive ranged from 1 to 6 months before recovery for molecular characterisation of ESBL genes. Clinical information related to each isolate, namely ward or clinic of origin, sample type, bacterial species name, and susceptibility towards third-generation cephalosporins, notably ceftriaxone, was extracted from the laboratory database. Laboratory procedures were conducted in Microbiology Research Laboratory and Molecular Biology Research Laboratory at the Catholic University of Health and Allied Sciences located at Bugando Medical Centre in Mwanza, Tanzania.
In the current study, HCAI was defined as an infection that a patient develops after 48 h of hospital admission, while receiving healthcare for another disease or condition.
Ceftriaxone-resistant GNB causing HCAIs were recovered by sub-culturing on plates of MacConkey agar with salt (MCA; HiMedia, Mumbai, India). Plates were incubated aerobically at 35 °C ± 2 °C for 20 h – 24 h followed by phenotypic detection of ESBL production and DNA extraction for multiplex polymerase chain reaction (PCR) assay. The disk combination method (DCM) from the Clinical and Laboratory Standards Institute
From 5 to 10 fresh colonies (≤ 24 h) of ceftriaxone-resistant GNB on plates of MCA were used for DNA extraction. A protocol for DNA extraction from GNB by QIAmp Min DNA extraction kit (QIAGEN, Wuerzburg, Germany) was used according to manufacturer’s instructions. DNA samples were stored at −20 °C.
A multiplex PCR assay described by Monstein et al.
Sequences of primers used for multiplex polymerase chain reaction assays for extended spectrum β-lactamase genes, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.
Primer | Sequence (5ʹ-3ʹ direction) | Amplicon size | Reference |
---|---|---|---|
ATGCGTTATATTCGCCTGTG | 747 bp | Monstein et al. |
|
TGCTTTGTTATTCGGGCCAA | |||
TEM-164.SE forward | TCGCCGCATACACTATTCTCAGAATGA | 445 bp | |
TEM-165.AS reverse | ACGCTCACCGGCTCCAGATTTAT | ||
CTX-M-U1 forward | ATGTGCAGYACCAGTAARGTKATGGC | 593 bp | |
CTX-M-U2 reverse | TGGGTRAARTARGTSACCAGAAYCAGCGG |
bp, base pairs.
Quantitative data were descriptively analysed by using Microsoft Excel (Microsoft Office; Redmond, Washington, United States) and Stata version 15.0 (StataCorp LLP; College Station, Texas, United States;
A total of 30 ceftriaxone-resistant GNB causing HCAIs were recovered during this study period. Most of the recovered bacteria were
Molecular characterisation of extended spectrum β-lactamase genes by multiplex polymerase chain reaction assay, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.
Description of ceftriaxone-resistant GNB recovered for multiplex polymerase chain reaction amplification and detection of extended spectrum β-lactamase genes, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.
Variable | Frequency ( |
Percentage (%) |
---|---|---|
Burn unit | 12 | 40.0 |
NICU | 7 | 23.3 |
PICU | 5 | 16.6 |
Medical ward | 4 | 13.3 |
AICU | 2 | 6.6 |
Pus or pus swab | 17 | 56.6 |
Urine | 7 | 23.3 |
Blood | 6 | 19.9 |
13 | 43.3 | |
7 | 23.3 | |
3 | 10.0 | |
3 | 10.0 | |
2 | 6.6 | |
1 | 3.3 | |
1 | 3.3 | |
Positive | 30 | 100.0 |
Negative | 0 | 0.0 |
Positive | 25 | 83.3 |
Negative | 5 | 16.7 |
|
23 | 92.0 |
|
18 | 64.2 |
|
2 | 8.0 |
Yes | 18 | 72.0 |
No | 1 | 28.0 |
|
16 | 88.8 |
|
1 | 5.6 |
|
1 | 5.6 |
AICU, adult intensive care unit; NICU, neonatal intensive care unit; PICU, paediatric intensive care unit; ESBL, extended spectrum β-lactamase; PCR, polymerase chain reaction.
Results of disk combination method and multiplex PCR assay, and distributions of ESBL genes, Bugando Medical Centre, Mwanza, Tanzania, January 2022 – July 2022.
Isolate ID | Ward/unit | Sample | Species name | DCM | PCR | ESBL family |
||
---|---|---|---|---|---|---|---|---|
SHV | TEM | CTX-M | ||||||
013HCAI | AICU | Blood | Pos | Pos | - | + | + | |
098HCAI | AICU | Urine | Pos | Pos | - | + | - | |
001HCAI | Burn unit | Pus | Pos | Pos | - | - | + | |
002HCAI | Burn unit | Pus | Pos | Pos | - | + | + | |
004HCAI | Burn unit | Pus | Pos | Pos | - | + | + | |
009HCAI | Burn unit | Pus | Pos | Pos | - | + | + | |
010HCAI | Burn unit | Pus | Pos | Pos | - | + | + | |
051HCAI | Burn unit | Pus | Pos | Pos | - | + | + | |
062HCAI | Burn unit | Pus | Pos | Neg | - | - | - | |
063HCAI | Burn unit | Pus | Pos | Pos | - | + | + | |
071HCAI | Burn unit | Pus | Pos | Neg | - | - | - | |
092HCAI | Burn unit | Pus | Pos | Pos | - | - | + | |
093HCAI | Burn unit | Pus | Pos | Pos | - | - | + | |
094HCAI | Burn unit | Pus | Pos | Neg | - | - | - | |
04HCAI-1 | Medical ward | Urine | Pos | Pos | - | + | + | |
04HCAI-2 | Medical ward | Urine | Pos | Pos | - | + | + | |
08HCAI | Medical ward | Urine | Pos | Neg | - | - | - | |
020HCAI | Medical ward | Urine | Pos | Pos | - | + | + | |
014HCAI | NICU | Pus | Pos | Neg | - | - | - | |
021HCAI-1 | NICU | Pus | Pos | Pos | - | + | + | |
021HCAI-2 | NICU | Pus | Pos | Pos | - | - | + | |
036HCAI | NICU | Pus | Pos | Pos | - | - | + | |
081HCAI | NICU | Blood | Pos | Pos | - | + | - | |
082HCAI | NICU | Blood | Pos | Pos | + | + | + | |
091HCAI | NICU | Pus | Pos | Pos | - | + | + | |
020HCAI | PICU | Blood | Pos | Pos | - | - | + | |
077HCAI | PICU | Blood | Pos | Pos | - | + | + | |
079HCAI-1 | PICU | Urine | Pos | Pos | - | + | + | |
079HCAI-2 | PICU | Urine | Pos | Pos | + | - | + | |
086HCAI | PICU | Blood | Pos | Pos | - | + | + |
HCAI, healthcare-associated infection; AICU, adult intensive care unit; NICU, neonatal intensive care unit; PICU, paediatric intensive care unit; DCM, disk combination method; ESBL, extended spectrum β-lactamase; SHV, sulfhydryl reagent variable beta-lactamase; TEM, temoniera beta-lactamase; CTX-M, cefotaximase-Munich β-lactamase; PCR, polymerase chain reaction; Pos, positive; Neg, negative.
The current study characterised the proportions and distributions of ESBL genes (
This study observed that all ceftriaxone-resistant GNB had positive ESBL phenotypes by DCM, even though four out of five (83.3%) ESBL phenotypes had at least one ESBL gene on multiplex PCR assay. Our findings are similar to a study by Silago et al., conducted in Mwanza, Tanzania, in 2020, which reported a proportion of 93.3% ESBL among GNB isolated from the hospital environment and hospitalised patients at the same setting.
Five confirmed ESBL phenotypes by DCM did not harbour any of the three ESBL genes (
The small sample size of ceftriaxone-resistant GNB isolates obtained for this study is a weakness but did not affect the interpretation of the results.
Extended spectrum β-lactamase genes, to be specific
Authors appreciate the support from Microbiology Research Laboratory and Molecular Biology Laboratory of the Catholic University of Health and Allied Sciences.
The authors declare that they have no financial or personal relationships that may have inappropriately influenced them in writing this article.
V.S. and A.A.M. conceptualised the idea of the manuscript; J.G.M. and S.M. retrieved laboratory data, recovered bacteria isolates, and performed laboratory procedures; J.G.M. and C.I.M. interpreted and analysed data; C.I.M. wrote the first draft of the manuscript, which was critically reviewed by all co-authors who also approved the final manuscript. V.S. supervised protocols and every step of this research.
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
The data that support the findings made in this study can be made available from the corresponding author, C.I.M., on request.
The views expressed in this study are those of the authors and are not an official position of the affiliation institutes of the authors.