Histology is used to identify Kaposi’s sarcoma (KS) in countries with low resources to fund healthcare costs. Approximately 95% of KS cases can be detected using a polymerase chain reaction.
To determine the presence of the open reading frame 75 (ORF75) gene associated with Kaposi’s sarcoma herpes virus among HIV-1/AIDS patients and to describe morphological presentations of KS.
This was a retrospective, descriptive study of archived tissue blocks collected from 2013 to 2016. Haematoxylin and eosin staining was used to identify KS. Deoxyribonucleic acid from archived tissue blocks was extracted and a nested polymerase chain reaction was used to detect the ORF75 gene.
All 81 cases in this study had been diagnosed as HIV-1 positive, of which 68 had hallmark features of KS in the histology report and 13 had features suggestive of KS (‘KS-like’). Microscopic identification of KS by haematoxylin and eosin staining was considered a significant indicator of KS herpes virus ORF75 gene positivity (
Following the initial diagnosis of KS by histology, the ORF75 gene was fur-ther detected from both cases that had hallmark features of KS as well as among cases with KS-like fea-tures.
Kaposi sarcoma (KS) is a tumor formed from blood vessels; it later shows lesions on the skin or organs of HIV-positive people.
Kaposi’s sarcoma is listed among the defining malignancies of HIV/AIDS.
In sub-Saharan Africa, KSHV is endemic and approximately 84% of worldwide cases of KS occur in this region.
The present study only included patients aged 18 years and older. Data on clinical information that was useful for this study were extracted from the registry records with the help of the data clerk. The following data were obtained from the registry records: sex, age, HIV-1 status, if patient was on antiretroviral or Highly Active Antiretroviral Therapy treatment, anatomic location of KS lesions, number of KS lesions, distribution of KS lesions, cluster of differentiation 4 cell count and histology diagnosis.
Study approval number P682/11/2014 was assigned by Kenyatta National Hospital/University of Nairobi Ethics and Research Committee.
A cross-sectional, descriptive, hospital-based study was used. Formalin-fixed, paraffin-embedded tissue blocks were retrieved from archives following histological reports of the patients who were diagnosed with KS or KS-like disease between 2013 and 2016. A consecutive sampling technique was used to select the archived tissue blocks from Thematic Unit of Anatomic Pathology, Department of Human Pathology, College of Health Sciences, University of Nairobi, and Department of Laboratory Medicine, Cytology Section, Kenyatta National Hospital.
For this study, a total of 81 tissue blocks were selected and analysed. A rotary microtome was used to section the formalin-fixed, paraffin-embedded blocks. A different blade was used for every formalin-fixed, paraffin-embedded block so as to avoid carry-over of genetic material. Once a block was cut, the microtomes surface was decontaminated using DNAZapTM PCR DNA degradation solution (catalog number: AM9890; Thermo Fisher Scientific, Waltham, Massachusetts, United States). Each tissue section was cut to 10 µm thick. The tissue sections were processed for haematoxylin and eosin staining and a qualified pathologist reported on the results.
Isolation of DNA from tissue sections was done using a GeneRead DNA FFPE kit (Qiagen, Hilden, Germany). The extraction kit removes paraffin and reverses formalin cross-links from tissue before DNA is bound to the QIAampMinElute column (Qiagen, Hilden, Germany). The eluted DNA is then ready to be used for nested PCR to detect the ORF75 gene in HHV-8. A Taq PCR Core Kit (catalog number: 201223; Qiagen, Hilden, Germany) was used to detect the ORF75 gene. The set of primers used were; ORF75 product size 895 bp Forward KS 1000 5′CGGTTCGGTGGCATACAGGC3′; Reverse KS 1034 5′CTGACTACAGAGGGTGTCCCCG3′.
The data were analysed using Statistical Package for Social Sciences version 21 (SPSS Inc Binghamton, New York, United States); the relationship between the ORF75 gene and clinical characteristics were tested by using chi-square and
Of the 81 tissue samples included in the study, 43.2% (35/81) were from women and 56.8% (46/81) were from men (
Crude prevalence odds ratio and 95% confidence intervals for patient characteristics and presence of the KSHV ORF75 gene, Nairobi, Kenya, 2013–2016.
Variables | Characteristics |
Positive ORF75 gene |
POR | 95% CI | |||
---|---|---|---|---|---|---|---|
% | % | ||||||
- | - | - | - | 1.2 | 0.48–2.94 | 0.70 | |
Male | 46 | 56.8 | 27 | 33.3 | - | - | - |
Female | 35 | 43.2 | 22 | 27.2 | - | - | - |
- | - | - | - | 1.05 | 1.00–1.11 | 0.047 |
|
18–29 years | 9 | 11.1 | 3 | 6.1 | - | - | - |
30–39 years | 39 | 48.1 | 21 | 42.9 | - | - | - |
40–49 years | 23 | 28.4 | 18 | 36.7 | - | - | - |
50–59 years | 6 | 7.4 | 5 | 10.2 | - | - | - |
60 years and above | 4 | 4.9 | 2 | 4.1 | - | - | - |
- | - | - | - | 0.64 | 0.09–4.78 | 0.66 | |
On ARVs | 77 | 95.1 | 47 | 95.9 | - | - | - |
HAART naïve | 4 | 4.9 | 2 | 4.1 | - | - | - |
- | - | - | - | 0.56 | 0.23–1.38 | 0.21 | |
> 10 | 45 | 55.6 | 30 | 61.2 | - | - | - |
< 10 | 36 | 44.4 | 19 | 38.8 | - | - | - |
- | - | - | - | 1.23 | 0.48–3.14 | 0.66 | |
Generalised | 53 | 65.4 | 33 | 67.4 | - | - | - |
Localised | 28 | 34.6 | 16 | 32.6 | - | - | - |
- | - | - | - | 12.31 | 2.51–60.49 | 0.002 |
|
KS | 68 | 84 | 47 | 95.9 | - | - | - |
KS-like | 13 | 16 | 2 | 4.1 | - | - | - |
ORF, open reading frame;
,
The mean age of patients with tissue blocks positive for the ORF75 gene was 41 years (standard deviation = 9.2; maximum age, 66 years; minimum age, 19 years). Detection of the ORF75 gene was most common in the 30–39 years age group (
In the histology report, 68 cases had hallmark features of KS, whereas 13 cases had features suggestive of KS (KS-like). The types of KS morphology identified included patchy, nodular, plaque and KS-like (
Morphological descriptions of Kaposi’s sarcoma and Ka-posi’s sarcoma-like cases, obtained from University of Nairobi and Kenyatta National Hospital, Nairobi, Kenya, 2013–2016. Microscopic identification by haematoxylin and eosin staining, X20. (a) Patchy, (b) Nodular, (c) Plaque and (d) KS-like.
The total number of KS cases diagnosed by histology was 68 (84%) and 13 cases (16%) had KS-like features (
The amplified ORF75 genes of HHV-8 were identified by 1% agarose gel electrophoresis (
Polymerase chain reaction agarose gel electrophoresis results of Ka-posi’s sarcoma herpes virus ORF75 gene. Cases obtained from University of Nairobi and Kenyatta National Hospital, Nairobi, Kenya, 2013–2016.
Retrieved clinical data revealed that all of the tissue blocks retrieved in the present study were collected from patients who had been diagnosed with HIV-1. These patients might have developed KS lesions due to immunosup-pression or because they were immunocomprised due to increased viral load that impaired their immune system. Other studies have also associated KS as an HIV/AIDS-defining illness.
The findings of this study revealed that men were more prone to development of KS: 56.8% (46/81) compared with women 43.2% (35/81). This observation is concordant with others who also noted more frequent development of KS among men.
Kaposi’s sarcoma immune reconstitution occurs when a portion of AIDS-KS cases responds to the introduction of combined antiretroviral therapy with disease advancement.
This study found patchy, plaque and nodular morphological presentations of KS. The morphological appearance of KS shows progression from plaques to nodular form and fungiform.
The decision in this study to use tissue biopsy for detection of the ORF75 gene of HHV-8 is in agreement with another study that supported the use of tumor biopsies as suitable for viral DNA identification due to high viral load as opposed to the use of blood.
Our study used the haematoxylin and eosin staining technique and the nested PCR method for detection of the ORF75 genes of the KSHV. However, HHV-8 immunohistochemical biopsy has been demonstrated to be the ‘gold standard’ for KS diagnosis.
The use of the PCR technique in the detection of KSHV has been shown to give the utmost specificity compared to the use of tests that determine exposure to infection.
The present study considered microscopic detection of KS by haematoxylin and eosin as a significant indicator of KSHV ORF75 gene positivity. It therefore recommends the use of both clinical diagnosis and routine microscopy in the diagnosis of KS in resource-limited facilities. However, among individuals with dark skin pigmentation, there is the need to employ the use of a robust diagnostic technique to ascertain the true causative agent.
The presence of the ORF75 gene of KSHV among immunosuppressed patients due to HIV-1 was successfully detected. Following the initial diagnosis of KS by histology, the ORF75 gene was further detected from both cases that had the hallmark features KS and those that had KS-like features. Microscopic detection of KS by haematoxylin and eosin should be considered a significant indicator of KSHV ORF75 gene positivity.
The authors of this manuscript would like to extend their gratitude to Kenyatta National Hospital and University of Nairobi for allowing them to use their archived tissue blocks.
The authors declare no conflict of interest.
R.N.D., S.M.A., M.M. and W.O.M. critically revised the manuscript for important intellectual content. R.N.D., S.M.A. and W.O.M. drafted the manuscript. R.N.D. and W.O.M. conceptualised and designed the study and ana-lysed and interpreted the data. R.N.D. and S.M.A. acquired the data.
This study was funded by the principal investigator (R.N.D.) as a fulfilment for the award of a postgraduate de-gree.
Data sharing is not applicable to this article as no new data were created or analysed in this study.
The views and opinions expressed in this article are those of the authors and do not necessarily reflect the offi-cial policy or position of any affiliated agency of the authors.